Settings

The page will reload to apply your changes.
Theme

ASCII Art Font

ASCII Art Menu

Original Usenet thread from alt.ascii-art, started 21 Jun 2000.
 _   _                     _        _             _     _           
| | | |___  ___ _ __   ___| |_     / \   _ __ ___| |__ (_)_   _____ 
| | | / __|/ _ \ '_ \ / _ \ __|   / _ \ | '__/ __| '_ \| \ \ / / _ \
| |_| \__ \  __/ | | |  __/ |_   / ___ \| | | (__| | | | |\ V /  __/
 \___/|___/\___|_| |_|\___|\__| /_/   \_\_|  \___|_| |_|_| \_/ \___|
One-Liners

One-Liners

alt.ascii-art · 37 messages · 21 Jun 2000 - 6 Jul 2000
Krogg <kro...@gtcom.net> ASCII art 21 Jun 2000 00:00 · permalink
bly wrote:
> 
> Can anyone recommend a good site for one-line ASCII art, like ><///>?  I'm
> looking for something unique for the From Line in newsgroups and email.
> Thanks in advance!
> bly

Here are some:
<%%%%|==========>                sword

---=                             fork

====\_/                          pipe

`o##o>                           car

 A                               clothes pin

C|_|                             coffee mug

>++('>                           fish bones

[|^^^^^^^                        hacksaw

 /\^/\__/|\T__                   looking down a road

  .                              particle man

 Y                               sling shot

=y-  -  -  --*                   thing from sling shot

<   >  /\ \/  L                  some boomerangs

.,.,\______/,..,.,.              canoe

*                                ninja star

 ((#))                           top view of a person

 ,.A..                           "middle finger"

 |--<                            side ways wine glass

 >--|                            its evil twin


|-o-|                             a small tie fighter i saw

"`-._,-'"`-._,-'"`-._,-'"`-._,-'  a wave or banner decor

|><|                              hour glass on side

^*_*^                             a forward facing smiley

//O\\                             a spider

'==xx\0                           a dead guy

'==>x\9                           a dead girl

'-=,o                             a dead child

.....`=o=^o>  <o^=o'.....         2 cars fixing to crash

.......`o=^o>    '-=,o            car about to run over dead child

..'...-=...,.o......`o=^o>        car ran over dead child

@[O],[O]                          dude with glasses

@(o),(o)                          another dude with glasses

O==I======>                       small sword

XXX-------->                      an arrow

--~~~=:>[XXXXXXXXX]>              a rocket

Y-Y^y^-/|\--Y^y^yY                looking ahead on a desert highway

``'//^\=Z  -=O                    a turtle after a tadpole

___/<^>\___                       front view of a stealth bomber

& &  >^\\\<|                      big fish going after little ones

~^~^~'====>`~^~^~^~^~             torpedo in water


-- 


|"""""<`.THE PRINCE ,'>"""""""""""""""""""""""""""""""""""|
|      `.`/""""""\,','            my sig is too big,      |
|SEE HIS (  /   \ \' SEE HIS      but its really cool.    |
| FACE    \/<> <>\/   SMILE                               |
|         /   W   \          Visit my ascii art site:     |
|       ,'\_|||||_/`.  http://www.gtcom.net/~krogg/ascii/ |
|     ,','   |||   `.`.     kro...@gtcom.net    |
|____<,' TIME TO DIE `.>____Remove no.to.spam to reply____|

Bateau <Its...@Not-A-Real-Address.com> ASCII art 22 Jun 2000 00:00 · permalink
On Wed, 21 Jun 2000 17:47:26 -0400 "bly" <nel...@hotmail.com> wrote:
>Can anyone recommend a good site for one-line ASCII art, like ><///>?  I'm
>looking for something unique for the From Line in newsgroups and email.
>Thanks in advance!

Hey that's a good idea =)
-- 
|    _              \      _       ^~      email:bateau at jupiterio.net
|   <')_,/     ,  ;  \   >(')__,  . ` '  ,  ,______________._
|   (_~=/    \._`.'.  \   (_~_/         _,  '------:_______  ;==( *BANG*
|    ='-      \=~_) ;  \ ~^~~^~   ` (_~_/            | | `-\ \    *BANG*
| ICQ:11367619 -'=      \           ~^~~^~           `~'    \_;

{-_-} Tjeerd {-_-} <990...@si.hhs.nl> ASCII art 23 Jun 2000 00:00 · permalink
:)              Happy
:(              Sad
>(              Pissed off
:P              Doh!
:/              Ah well...
:?              What?
(:P             Happy with cap
[..cut..] (otherwise I wasn't finished yet)
,-              Gun
{-_-}           Baby-face
,==,--          machinegun
,=|-            tommy gun
qp              bug
<o><o>          eyes
<$><$>          capitalistic eyes?
~<-)            mouse (of a computer)
:.:.:.:.:.:     top of castle wall
=|--            dagger
(/\)            Pac man
X+X+X+X+X       Roadblock

> (/\)            Pac man
        how about this PacMan  (< ***  ? :))

greetings, 

	Piotrek.

Alex Dethler <ale...@netscape.net> ASCII art 23 Jun 2000 00:00 · permalink

{-_-} Tjeerd {-_-} wrote:
> 
> :)              Happy
> :(              Sad
> >(              Pissed off
> :P              Doh!
> :/              Ah well...
> :?              What?
> (:P             Happy with cap
> [..cut..] (otherwise I wasn't finished yet)
> ,-              Gun
> {-_-}           Baby-face
> ,==,--          machinegun
> ,=|-            tommy gun
> qp              bug
> <o><o>          eyes
> <$><$>          capitalistic eyes?
> ~<-)            mouse (of a computer)

--( :>            just junior mouse

--( 8:>           senior mouse

.>>>8*            caterpillar

.))))8*           caterpillar1

.|||||8*          caterpillar2


> :.:.:.:.:.:     top of castle wall
> =|--            dagger
> (/\)            Pac man
> X+X+X+X+X       Roadblock


               __________     mailto:    
              /\__  __/\WW    ad at      
             |    \/    |WW   nu.umn.ru  
             \ <*>||<*> /WWW             
              |   oo   |\WWWW            
               \VvvvvV/ /WWWW            
                (^^^^) /WWWW             
                /||||_/WWWW              
               /_____/WWWW  ADGROUP-RIPN 
              /_____/WWWW                
 /^^^^^\   From Hell With Love,   /^^^^\ 
=\/\/\/===|  Always yours, ad  |==\/\/\/=
=========================================

Fulgore <ful...@mindspring.com> ASCII art 23 Jun 2000 00:00 · permalink
()()():|	Marge Simpson
^_^		Anime smiley
(<>..<>)	Aliens!
=0.0=		ASCII KITII

-- 
  .-'"T"'-.   Fulgore, The Slighty Mad!
 /    |    \  E-mail :ful...@mindspring.com
|     |     | Webpage:http://www.mindspring.com/~fulgore/main.html
|    .|.    | ICQ    :30360347
 \ .' | '. /  DC2    :DC2.D Gm A- L- W T Pawl Bzz Fo/j+ R+++ Ac+ Cwh/bl_
sw'-.,|,.-'           J+++! Ns S+ Fr+++! U! I H++ M--- Q+++! Tc++ Skm

Krogg <kro...@gtcom.net> ASCII art 23 Jun 2000 00:00 · permalink
Fulgore wrote:
> 
> ()()():|        Marge Simpson
> ^_^             Anime smiley
> (<>..<>)        Aliens!
> =0.0=           ASCII KITII
> 


     .()(). 
    ()()():|
    ()()():|
    ()()():|
    ()()():|
    ()()():| 
    ()()():|       "Marge_Simpson_Anime_smiley_Aliens_ASCII_KITII"
    |`^__^'|        
  \ (<>..<>) /     (C) 2000 Krogg  
   `>=-..-=<'       
      _) |_
    


|"""""<`.THE PRINCE ,'>"""""""""""""""""""""""""""""""""""|
|      `.`/""""""\,','            my sig is too big,      |
|SEE HIS (  /   \ \' SEE HIS      but its really cool.    |
| FACE    \/<> <>\/   SMILE                               |
|         /   W   \          Visit my ascii art site:     |
|       ,'\_|||||_/`.  http://www.gtcom.net/~krogg/ascii/ |
|     ,','   |||   `.`.     kro...@gtcom.net    |
|____<,' TIME TO DIE `.>____Remove no.to.spam to reply____|

Yorck Babinsky <Yor...@web.de> ASCII art 24 Jun 2000 00:00 · permalink
Howdy

Andreas Krennmair schrieb:
> 
> On Sat, 24 Jun 2000 17:04:17 +0200, Yorck Babinsky <Yor...@web.de> wrote:
> > =(:o)    Homer simpson
> You forgot the most important thing, Homer's famous quote:
> =(:o) <(d'oh!)

Yeah, right!How could i forget that? Shame on me!

-- 
            \\//o\__ __   (o) |\ /|\___ __  :-(o_)^(o_)-:[THA ULTIMATIVE]
 .:::::::::. []\_/o ) /   (\\ ||V||o\o ) /_ :     <     : //"\\||//|\ /|
:' __   __ ':    ||\\_\||//         ||\\_\o\:.  _..._  .: ||\\|| ( ||V||
:-( o)^( o)-:          ||\\              \_/ :. '---' .:  \\_\\||\\|| ||

Yorck Babinsky <Yor...@web.de> ASCII art 24 Jun 2000 00:00 · permalink
Hey
 
> > �:-=(    Uhm, a guy that started the 2nd World war...
> 
> Rediddle:
> 
> (/:o=(

hm, the hair isnt absolut correct!
Any help for that?

-- 
            \\//o\__ __   (o) |\ /|\___ __  :-(o_)^(o_)-:[THA ULTIMATIVE]
 .:::::::::. []\_/o ) /   (\\ ||V||o\o ) /_ :     <     : //"\\||//|\ /|
:' __   __ ':    ||\\_\||//         ||\\_\o\:.  _..._  .: ||\\|| ( ||V||
:-( o)^( o)-:          ||\\              \_/ :. '---' .:  \\_\\||\\|| ||

"Jennifer \"Jennova, Angelface of Death\" Martino" <noih83m@il.com> ASCII art 24 Jun 2000 00:00 · permalink
Fulgore wrote:
> 
> ()()():|        Marge Simpson

ive also seen @@@@:| for marge simpson.

> --
>   .-'"T"'-.   Fulgore, The Slighty Mad!
>  /    |    \  E-mail :ful...@mindspring.com
> |     |     | Webpage:http://www.mindspring.com/~fulgore/main.html
> |    .|.    | ICQ    :30360347
>  \ .' | '. /  DC2    :DC2.D Gm A- L- W T Pawl Bzz Fo/j+ R+++ Ac+ Cwh/bl_
> sw'-.,|,.-'           J+++! Ns S+ Fr+++! U! I H++ M--- Q+++! Tc++ Skm
--
          The Web Page You Have Reached
	     http://twpyhr.usuck.com               ___________
           Over 250 telephone sounds and          /  _     _  \
         recordings, The Unofficial Touch        |__[ L___I ]__|
        Tone Tune FAQ, and The Phoney Dance.       |         |
             ,@@@,            ,@@@@@,              |   :::   |
          ,@@"   "@@@,     ,@@"     "@@@,    ,@@@@"|   :::   |
    "@@@@@"          "@@@@@"            "@@@@"     '========='
original ascii art by joan stark:slightly modified by jennifer martino

)===D----
I think you all know...
--

  "Quis custodiet ipsos custodes?" - Juvenal, Satires, VI, 347

Fulgore <ful...@mindspring.com> ASCII art 24 Jun 2000 00:00 · permalink
I almost forot to do the dragon smileys...

}:=8)	Dragon
}:===8)	Long snouted dragon
};=8P	Dragon jokin around
}:=X8)	Cat Dragon
}:=8o	Dragon with mouth open (probably blowing fire)

-- 
  .-'"T"'-.   Fulgore, The Slighty Mad!
 /    |    \  E-mail :ful...@mindspring.com
|     |     | Webpage:http://www.mindspring.com/~fulgore/main.html
|    .|.    | ICQ    :30360347
 \ .' | '. /  DC2    :DC2.D Gm A- L- W T Pawl Bzz Fo/j+ R+++ Ac+ Cwh/bl_
sw'-.,|,.-'           J+++! Ns S+ Fr+++! U! I H++ M--- Q+++! Tc++ Skm

Yorck Babinsky <Yor...@web.de> ASCII art 24 Jun 2000 00:00 · permalink
Hi
=(:o)    Homer simpson
=8-)     Myself	
08-)     Angel
�:-=(    Uhm, a guy that started the 2nd World war...
[-)      Guy with Sunglasses
:8-)     �hm, marscho?;-)
:-?      Smoker	
-(:==    the last Unicorn
:=O: |   Alien
+-:-|    the Pope!
 
-- 
            \\//o\__ __   (o) |\ /|\___ __  :-(o_)^(o_)-:[THA ULTIMATIVE]
 .:::::::::. []\_/o ) /   (\\ ||V||o\o ) /_ :     <     : //"\\||//|\ /|
:' __   __ ':    ||\\_\||//         ||\\_\o\:.  _..._  .: ||\\|| ( ||V||
:-( o)^( o)-:          ||\\              \_/ :. '---' .:  \\_\\||\\|| ||

On Sat, 24 Jun 2000 17:04:17 +0200, Yorck Babinsky <Yor...@web.de>
decided to tell us all:

> �:-=(    Uhm, a guy that started the 2nd World war...

Rediddle:

(/:o=(
-- 
mailto:sara(a)wallen.as ** icq:32690270 ** http://www.saraw.clara.net
Non illegitimi carborundum est. Don't let the bastards grind you down.

nobody <"no...@%20.%20$1\\n\\r\\> ASCII art 24 Jun 2000 00:00 · permalink
 ^O^   Bats
       ^O^          ^O^            ^O^         ^O^
 ^O^      ^O^           ^O^              ^O^             ^O^
          ^O^                   ^O^      ^O^          
^O^              
   ^O^            ^O^                          ^O^              ^O^
^O^
bly
-- 
 _     /�#     ----------------+-------------------------
�  \  /        Andrea          | arimicci @@
   |++~|            Rimicci    |         aritaly. com
    \ /  --------- OS/2 V5 "Phoenix" --------------------
     |   The MIDI JukeBox:
    _|_                  http://www.aritaly.com/eng/midi/
---------------------------------------------------------

Fulgore <ful...@mindspring.com> ASCII art 24 Jun 2000 00:00 · permalink
>  ^O^   Bats
>        ^O^          ^O^            ^O^         ^O^
>  ^O^      ^O^           ^O^              ^O^             ^O^
>           ^O^                   ^O^      ^O^
> ^O^
>    ^O^            ^O^                          ^O^              ^O^
> ^O^
> bly

or you could...


     ___
    |   |
    |   |
    |   |
    |   |
    |   |
    |   |
    |   |
    |   |
    |   |
    |===|
    |   |
    \   /
     | |
     |_|
     

-- 
  .-'"T"'-.   Fulgore, The Slighty Mad!
 /    |    \  E-mail :ful...@mindspring.com
|     |     | Webpage:http://www.mindspring.com/~fulgore/main.html
|    .|.    | ICQ    :30360347
 \ .' | '. /  DC2    :DC2.D Gm A- L- W T Pawl Bzz Fo/j+ R+++ Ac+ Cwh/bl_
sw'-.,|,.-'           J+++! Ns S+ Fr+++! U! I H++ M--- Q+++! Tc++ Skm

On Sat, 24 Jun 2000 17:04:17 +0200, Yorck Babinsky <Yor...@web.de> wrote:
> =(:o)    Homer simpson
You forgot the most important thing, Homer's famous quote:
=(:o) <(d'oh!)

Andreas Krennmair
-- 
#define QUESTION ((bb) || !(bb))
  -- Shakespeare

On Sat, 24 Jun 2000 17:05:04 +0100, sara wallen
<sar...@REMOVE2REPLYyahoo.co.uk> provoked the following text:

>> �:-=(    Uhm, a guy that started the 2nd World war...
>
>Rediddle:
>
>(/:o=(

I find this one more accurate: 
':=(
--
        Peter Punk
          \    /
        ---\\\\---
          /    \

Visit my MIDI-site at http://members.xoom.com/miditation

An Englishman never enjoys himself, except for a noble purpose. -- A. P. Herbert

Yorck Babinsky <Yor...@web.de> ASCII art 25 Jun 2000 00:00 · permalink
Howdy

> }:=8o   Dragon with mouth open (probably blowing fire)

   ):=8? Dragon without fire!Only smoke!
scnr 

-- 
            \\//o\__ __   (o) |\ /|\___ __  :-(o_)^(o_)-:[THA ULTIMATIVE]
 .:::::::::. []\_/o ) /   (\\ ||V||o\o ) /_ :     <     : //"\\||//|\ /|
:' __   __ ':    ||\\_\||//         ||\\_\o\:.  _..._  .: ||\\|| ( ||V||
:-( o)^( o)-:          ||\\              \_/ :. '---' .:  \\_\\||\\|| ||

Yorck Babinsky <Yor...@web.de> ASCII art 25 Jun 2000 00:00 · permalink

Peter Punk schrieb:
> 
> On Sat, 24 Jun 2000 17:05:04 +0100, sara wallen
> <sar...@REMOVE2REPLYyahoo.co.uk> provoked the following text:
> 
> >> �:-=(    Uhm, a guy that started the 2nd World war...
> >
> >Rediddle:
> >
> >(/:o=(
> 
> I find this one more accurate:
> ':=(

Yeah, that was what i was triyung to show!
-- 
            \\//o\__ __   (o) |\ /|\___ __  :-(o_)^(o_)-:[THA ULTIMATIVE]
 .:::::::::. []\_/o ) /   (\\ ||V||o\o ) /_ :     <     : //"\\||//|\ /|
:' __   __ ':    ||\\_\||//         ||\\_\o\:.  _..._  .: ||\\|| ( ||V||
:-( o)^( o)-:          ||\\              \_/ :. '---' .:  \\_\\||\\|| ||

On 24 Jun 2000 19:12:39 GMT, a.k...@aon.at (Andreas Krennmair)
wrote:

>On Sat, 24 Jun 2000 17:04:17 +0200, Yorck Babinsky <Yor...@web.de> wrote:
>> =(:o)    Homer simpson
>You forgot the most important thing, Homer's famous quote:
>=(:o) <(d'oh!)

(_8(|)  < D'OH!)
 
-- 
Jan-Erik Finnberg           whe...@saunalahti.fi           ICQ:49316651

Visit http://www.saunalahti.fi/~wheany/FFVII/
for Final fantasy 7 midis and not much more!!

Jan-Erik Finnberg <whe...@saunalahti.fi> ASCII art 25 Jun 2000 00:00 · permalink
On Sat, 24 Jun 2000 11:24:27 -0700, Fulgore <ful...@mindspring.com>
wrote:

:>  ^O^   Bats

:or you could...
:     ___
:    |   |
:    |   |
:    |   |
:    |   |
:    |   |
:    |   |
:    |   |
:    |   |
:    |   |
:    |===|
:    |   |
:    \   /
:     | |
:     |_|
     
And a one-liner:  (#######)==o


-- 
Jan-Erik Finnberg           whe...@saunalahti.fi           ICQ:49316651

Visit http://www.saunalahti.fi/~wheany/FFVII/
for Final fantasy 7 midis and not much more!!

Hi!

Yorck Babinsky wrote:

> > > О©╫:-=(    Uhm, a guy that started the 2nd World war...
> > Rediddle:
> > (/:o=(
> hm, the hair isnt absolut correct!
> Any help for that?


 y:= x

Maybe, this one??



ad

Alex Dethler <ale...@netscape.net> ASCII art 25 Jun 2000 00:00 · permalink

Fulgore wrote:
> I almost forot to do the dragon smileys...
> }:=8)   Dragon
> }:===8) Long snouted dragon
> };=8P   Dragon jokin around
> }:=X8)  Cat Dragon
> }:=8o   Dragon with mouth open (probably blowing fire)


-= dragon quotation I'm using =:)
           any smile goes here ^^

                              )
-= full variant has 3 strings =:o
                              )



               __________     mailto:    
              /\__  __/\WW    ad at      
             |    \/    |WW   nu.umn.ru  
             \ <*>||<*> /WWW             
              |   oo   |\WWWW            
               \VvvvvV/ /WWWW            
                (^^^^) /WWWW             
                /||||_/WWWW              
               /_____/WWWW  ADGROUP-RIPN 
              /_____/WWWW                
 /^^^^^\   From Hell With Love,   /^^^^\ 
=\/\/\/===|  Always yours, ad  |==\/\/\/=
=========================================

On Sun, 25 Jun 2000 19:34:15 +0200, Yorck Babinsky <Yor...@web.de> provoked the
following text:

>> >> �:-=(    Uhm, a guy that started the 2nd World war...
>> >Rediddle:
>> >(/:o=(
>> I find this one more accurate:
>> ':=(
>Yeah, that was what i was triyung to show!

But i perfer to depict him like this:

*
What's left of him now.
--
        Peter Punk
          \    /
        ---\\\\---
          /    \

Visit my MIDI-site at http://members.xoom.com/miditation

Slang is language that takes off its coat, spits on its hands, and goes to work.

Yorck Babinsky <Yor...@web.de> ASCII art 26 Jun 2000 00:00 · permalink
Hey 
> But i perfer to depict him like this:
> 
> *

yeah, its better this way!


-- 
            \\//o\__ __   (o) |\ /|\___ __  :-(o_)^(o_)-:[THA ULTIMATIVE]
 .:::::::::. []\_/o ) /   (\\ ||V||o\o ) /_ :     <     : //"\\||//|\ /|
:' __   __ ':    ||\\_\||//         ||\\_\o\:.  _..._  .: ||\\|| ( ||V||
:-( o)^( o)-:          ||\\              \_/ :. '---' .:  \\_\\||\\|| ||

Yorck Babinsky <Yor...@web.de> ASCII art 26 Jun 2000 00:00 · permalink
hi
> 
>  y:= x
> 
> Maybe, this one??
> 
Ok!
but we alread closed that x-file!;-)

-- 
            \\//o\__ __   (o) |\ /|\___ __  :-(o_)^(o_)-:[THA ULTIMATIVE]
 .:::::::::. []\_/o ) /   (\\ ||V||o\o ) /_ :     <     : //"\\||//|\ /|
:' __   __ ':    ||\\_\||//         ||\\_\o\:.  _..._  .: ||\\|| ( ||V||
:-( o)^( o)-:          ||\\              \_/ :. '---' .:  \\_\\||\\|| ||

Hi, Jennifer!

 >> ()()():|        Marge Simpson
 nm> ive also seen @@@@:| for marge simpson.
See what i find:

,',',',',:)

:)
P.S. Maybe, my english is bad - sorry. I'm speak at rusian and ukrainian.
P.P.S. (russian translit) Est' li zdes' russkie amerikanci (emigranti, etc.
)? :)
Good luck, Jennifer!


Anatoly Pavlov wrote:

>  >> ()()():|        Marge Simpson
>  nm> ive also seen @@@@:| for marge simpson.
> See what i find:
> ,',',',',:)


o=|8o) a clown



> P.S. Maybe, my english is bad - sorry.
> I'm speak at rusian and ukrainian.
> P.P.S. (russian translit) Est' li zdes'
> russkie amerikanci (emigranti, etc.)? :)

Why d'you need emigrants here??

And what a sentence - russian americans??




PS. Russian translit, 2 Anatoly:
A chego eto tebye emigranty-to ponadobilis'??



ad

{-_-} Tjeerd {-_-} <990...@si.hhs.nl> ASCII art 29 Jun 2000 00:00 · permalink
,_(|=|     Boba Fett (Star Wars)

( |:-|)    Bob Ross (the (dead) painter)

| :-)      Myself

 |-|       Frank de Boer (Dutch footballer (soccer), famous of his
"anoyed" look)

 |-|       Ronald de Boer (Dutch footballer, twin brother of the first
one)


bly wrote:
> 
> Can anyone recommend a good site for one-line ASCII art, like ><///>?  I'm

A few below


/s\          superman logo
\,(          kick in the pants
~            DNA sample
|M|/         mail box
(`.<o><      catching a fish
(`.~         worm on the hook
(`.          fishing pole
/`.          lazy day
! -/--- !    The pen is mightier than the sword
O='`o        motor cycle


--lgbeard

Yorck Babinsky <Yor...@web.de> ASCII art 30 Jun 2000 00:00 · permalink
Hey!

:^)  somebody with a strange Nose!
:-!  Another Smoker!
$:(|) homer simpson again...
:-�)  the Girl from Hotshots!
-- 
            \\//o\__ __   (o) |\ /|\___ __  :-(o_)^(o_)-:[THA ULTIMATIVE]
 .:::::::::. []\_/o ) /   (\\ ||V||o\o ) /_ :     <     : //"\\||//|\ /|
:' __   __ ':    ||\\_\||//         ||\\_\o\:.  _..._  .: ||\\|| ( ||V||
:-( o)^( o)-:          ||\\              \_/ :. '---' .:  \\_\\||\\|| ||

Jan-Erik Finnberg <whe...@saunalahti.fi> ASCII art 1 Jul 2000 00:00 · permalink
On Fri, 30 Jun 2000 18:28:57 +0100, Ben Norwood <bdn...@aber.ac.uk>
wrote:

>AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA

Where'd ya get that! That's part of my DNA. It's bad to post private
emails to public groups, but it's even worse to post one's DNA.

ObActuallyThisIsn'tAsciiArtButItDoesn'tHaveAnyNonAsciiCharsEither

Space-dna:

AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA  
 
Obascii:
                                   
         ___                       
       _(((,|    What's DNA??         
      /  _-\\                       
     / C o\o \                     
   _/_    __\ \     __ __     __ __     __ __     __
  /   \ \___/  )   /--X--\   /--X--\   /--X--\   /--
  |    |\_|\  /   /--/ \--\ /--/ \--\ /--/ \--\ /--/
  |    |#  #|/          \__X__/   \__X__/   \__X__/ 
  (   /     | 
   |  |#  # | 
   |  |    #|                      
   |  | #___n_,_                  
,-/   7-' .     `\                 
`-\...\-_   -  o /                 
   |#  # `---U--'                  
   `-v-^-'\/                       
     \  |_|_ Wny                  
     (___mnnm                  



-- 
Jan-Erik Finnberg           whe...@saunalahti.fi           ICQ:49316651

Visit http://www.saunalahti.fi/~wheany/FFVII/
for Final fantasy 7 midis and not much more!!

--( In alt.ascii-art )--
		--(Jan-Erik Finnberg said it like only they can)--
$On Fri, 30 Jun 2000 18:28:57 +0100, Ben Norwood <bdn...@aber.ac.uk>
$wrote:
$
$>AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA
$
$Where'd ya get that! That's part of my DNA. It's bad to post private
$emails to public groups, but it's even worse to post one's DNA.
$
$ObActuallyThisIsn'tAsciiArtButItDoesn'tHaveAnyNonAsciiCharsEither
$
$Space-dna:
$
$AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA  

your dna? thats my dna!

unless you are my long lost twin :)



--
 ._______.                                         ._______.
 | <> <> |  To all who say evolution is to slow to | <> <> |
  \-|o|-/  make a race as advanced as ours I have   \-|o|-/
   /___\  only one thing to say. Have you ever seen  /___\
   (MMM)  the Jerry Springer Show?    UIN=66618055   (MMM)

Faux_Pseudo wrote:
> 
> --( In alt.ascii-art )--
>                 --(Jan-Erik Finnberg said it like only they can)--
> $On Fri, 30 Jun 2000 18:28:57 +0100, Ben Norwood <bdn...@aber.ac.uk>
> $wrote:
> $
> $>AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA
> $
> $Where'd ya get that! That's part of my DNA. It's bad to post private
> $emails to public groups, but it's even worse to post one's DNA.
> $
> $ObActuallyThisIsn'tAsciiArtButItDoesn'tHaveAnyNonAsciiCharsEither
> $
> $Space-dna:
> $
> $AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA
> 
> your dna? thats my dna!

  somebody somewhere sometime for 29.95 will sell it
> 
> unless you are my long lost twin :)

 never let him borrow the t-cells...robbed at youth...

   __
  )==(  
 (    ) Herbal
  |  |  Elixir
  |  |  China Variety
 (____)


--lgbeard

On Sun, 02 Jul 2000 07:45:23 GMT, Fau...@computer.foo.bar
(Faux_Pseudo) wrote:

>$>AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA

>$Where'd ya get that! That's part of my DNA. It's bad to post private
>$emails to public groups, but it's even worse to post one's DNA.

>$ObActuallyThisIsn'tAsciiArtButItDoesn'tHaveAnyNonAsciiCharsEither

>$Space-dna:

>$AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA  

>your dna? thats my dna!

You can have the space-DNA, I think I'll hold on to the boring-yet-safe
earthling DNA.
                                                      _________________
                                                     ( MWAHAHAHAHAA!!! )
                                                                  Y
  _     AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA  '.
  Y --(Aww, crap!)                                     - ----   \C_/
 <|\                                                  -  ----    |_
 / \AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA  '\/  \,


-- 
Jan-Erik Finnberg           whe...@saunalahti.fi           ICQ:49316651

Visit http://www.saunalahti.fi/~wheany/FFVII/
for Final fantasy 7 midis and not much more!!

>> >> �:-=(    Uhm, a guy that started the 2nd World war...
>> >Rediddle:
>> >(/:o=(
>> I find this one more accurate:
>> ':=(
>Yeah, that was what i was triyung to show!

I'd say it's better this way:

7:=(

About this thread. These messages were posted publicly to the newsgroup alt.ascii-art in 2000 and are mirrored here unchanged as part of the Historic Archives – only email addresses are masked. The artwork and text belong to their original authors: if you copy a piece, keep the artist's initials or signature intact and credit them where you can. Are you one of the authors? Contact us to get your posts attributed, connected to your artist profile, or removed.