Original Usenet thread from alt.ascii-art, started 21 Jun 2000.
One-Liners
alt.ascii-art
· 37 messages · 21 Jun 2000 - 6 Jul 2000
bly wrote: > > Can anyone recommend a good site for one-line ASCII art, like ><///>? I'm > looking for something unique for the From Line in newsgroups and email. > Thanks in advance! > bly Here are some: <%%%%|==========> sword ---= fork ====\_/ pipe `o##o> car A clothes pin C|_| coffee mug >++('> fish bones [|^^^^^^^ hacksaw /\^/\__/|\T__ looking down a road . particle man Y sling shot =y- - - --* thing from sling shot < > /\ \/ L some boomerangs .,.,\______/,..,.,. canoe * ninja star ((#)) top view of a person ,.A.. "middle finger" |--< side ways wine glass >--| its evil twin |-o-| a small tie fighter i saw "`-._,-'"`-._,-'"`-._,-'"`-._,-' a wave or banner decor |><| hour glass on side ^*_*^ a forward facing smiley //O\\ a spider '==xx\0 a dead guy '==>x\9 a dead girl '-=,o a dead child .....`=o=^o> <o^=o'..... 2 cars fixing to crash .......`o=^o> '-=,o car about to run over dead child ..'...-=...,.o......`o=^o> car ran over dead child @[O],[O] dude with glasses @(o),(o) another dude with glasses O==I======> small sword XXX--------> an arrow --~~~=:>[XXXXXXXXX]> a rocket Y-Y^y^-/|\--Y^y^yY looking ahead on a desert highway ``'//^\=Z -=O a turtle after a tadpole ___/<^>\___ front view of a stealth bomber & & >^\\\<| big fish going after little ones ~^~^~'====>`~^~^~^~^~ torpedo in water -- |"""""<`.THE PRINCE ,'>"""""""""""""""""""""""""""""""""""| | `.`/""""""\,',' my sig is too big, | |SEE HIS ( / \ \' SEE HIS but its really cool. | | FACE \/<> <>\/ SMILE | | / W \ Visit my ascii art site: | | ,'\_|||||_/`. http://www.gtcom.net/~krogg/ascii/ | | ,',' ||| `.`. kro...@gtcom.net | |____<,' TIME TO DIE `.>____Remove no.to.spam to reply____|
On Wed, 21 Jun 2000 17:47:26 -0400 "bly" <nel...@hotmail.com> wrote: >Can anyone recommend a good site for one-line ASCII art, like ><///>? I'm >looking for something unique for the From Line in newsgroups and email. >Thanks in advance! Hey that's a good idea =) -- | _ \ _ ^~ email:bateau at jupiterio.net | <')_,/ , ; \ >(')__, . ` ' , ,______________._ | (_~=/ \._`.'. \ (_~_/ _, '------:_______ ;==( *BANG* | ='- \=~_) ; \ ~^~~^~ ` (_~_/ | | `-\ \ *BANG* | ICQ:11367619 -'= \ ~^~~^~ `~' \_;
:) Happy
:( Sad
>( Pissed off
:P Doh!
:/ Ah well...
:? What?
(:P Happy with cap
[..cut..] (otherwise I wasn't finished yet)
,- Gun
{-_-} Baby-face
,==,-- machinegun
,=|- tommy gun
qp bug
<o><o> eyes
<$><$> capitalistic eyes?
~<-) mouse (of a computer)
:.:.:.:.:.: top of castle wall
=|-- dagger
(/\) Pac man
X+X+X+X+X Roadblock
> (/\) Pac man
how about this PacMan (< *** ? :))
greetings,
Piotrek.
{-_-} Tjeerd {-_-} wrote:
>
> :) Happy
> :( Sad
> >( Pissed off
> :P Doh!
> :/ Ah well...
> :? What?
> (:P Happy with cap
> [..cut..] (otherwise I wasn't finished yet)
> ,- Gun
> {-_-} Baby-face
> ,==,-- machinegun
> ,=|- tommy gun
> qp bug
> <o><o> eyes
> <$><$> capitalistic eyes?
> ~<-) mouse (of a computer)
--( :> just junior mouse
--( 8:> senior mouse
.>>>8* caterpillar
.))))8* caterpillar1
.|||||8* caterpillar2
> :.:.:.:.:.: top of castle wall
> =|-- dagger
> (/\) Pac man
> X+X+X+X+X Roadblock
__________ mailto:
/\__ __/\WW ad at
| \/ |WW nu.umn.ru
\ <*>||<*> /WWW
| oo |\WWWW
\VvvvvV/ /WWWW
(^^^^) /WWWW
/||||_/WWWW
/_____/WWWW ADGROUP-RIPN
/_____/WWWW
/^^^^^\ From Hell With Love, /^^^^\
=\/\/\/===| Always yours, ad |==\/\/\/=
=========================================
()()():| Marge Simpson ^_^ Anime smiley (<>..<>) Aliens! =0.0= ASCII KITII -- .-'"T"'-. Fulgore, The Slighty Mad! / | \ E-mail :ful...@mindspring.com | | | Webpage:http://www.mindspring.com/~fulgore/main.html | .|. | ICQ :30360347 \ .' | '. / DC2 :DC2.D Gm A- L- W T Pawl Bzz Fo/j+ R+++ Ac+ Cwh/bl_ sw'-.,|,.-' J+++! Ns S+ Fr+++! U! I H++ M--- Q+++! Tc++ Skm
Fulgore wrote: > > ()()():| Marge Simpson > ^_^ Anime smiley > (<>..<>) Aliens! > =0.0= ASCII KITII > .()(). ()()():| ()()():| ()()():| ()()():| ()()():| ()()():| "Marge_Simpson_Anime_smiley_Aliens_ASCII_KITII" |`^__^'| \ (<>..<>) / (C) 2000 Krogg `>=-..-=<' _) |_ |"""""<`.THE PRINCE ,'>"""""""""""""""""""""""""""""""""""| | `.`/""""""\,',' my sig is too big, | |SEE HIS ( / \ \' SEE HIS but its really cool. | | FACE \/<> <>\/ SMILE | | / W \ Visit my ascii art site: | | ,'\_|||||_/`. http://www.gtcom.net/~krogg/ascii/ | | ,',' ||| `.`. kro...@gtcom.net | |____<,' TIME TO DIE `.>____Remove no.to.spam to reply____|
Howdy Andreas Krennmair schrieb: > > On Sat, 24 Jun 2000 17:04:17 +0200, Yorck Babinsky <Yor...@web.de> wrote: > > =(:o) Homer simpson > You forgot the most important thing, Homer's famous quote: > =(:o) <(d'oh!) Yeah, right!How could i forget that? Shame on me! -- \\//o\__ __ (o) |\ /|\___ __ :-(o_)^(o_)-:[THA ULTIMATIVE] .:::::::::. []\_/o ) / (\\ ||V||o\o ) /_ : < : //"\\||//|\ /| :' __ __ ': ||\\_\||// ||\\_\o\:. _..._ .: ||\\|| ( ||V|| :-( o)^( o)-: ||\\ \_/ :. '---' .: \\_\\||\\|| ||
Hey > > �:-=( Uhm, a guy that started the 2nd World war... > > Rediddle: > > (/:o=( hm, the hair isnt absolut correct! Any help for that? -- \\//o\__ __ (o) |\ /|\___ __ :-(o_)^(o_)-:[THA ULTIMATIVE] .:::::::::. []\_/o ) / (\\ ||V||o\o ) /_ : < : //"\\||//|\ /| :' __ __ ': ||\\_\||// ||\\_\o\:. _..._ .: ||\\|| ( ||V|| :-( o)^( o)-: ||\\ \_/ :. '---' .: \\_\\||\\|| ||
Fulgore wrote: > > ()()():| Marge Simpson ive also seen @@@@:| for marge simpson. > -- > .-'"T"'-. Fulgore, The Slighty Mad! > / | \ E-mail :ful...@mindspring.com > | | | Webpage:http://www.mindspring.com/~fulgore/main.html > | .|. | ICQ :30360347 > \ .' | '. / DC2 :DC2.D Gm A- L- W T Pawl Bzz Fo/j+ R+++ Ac+ Cwh/bl_ > sw'-.,|,.-' J+++! Ns S+ Fr+++! U! I H++ M--- Q+++! Tc++ Skm -- The Web Page You Have Reached http://twpyhr.usuck.com ___________ Over 250 telephone sounds and / _ _ \ recordings, The Unofficial Touch |__[ L___I ]__| Tone Tune FAQ, and The Phoney Dance. | | ,@@@, ,@@@@@, | ::: | ,@@" "@@@, ,@@" "@@@, ,@@@@"| ::: | "@@@@@" "@@@@@" "@@@@" '=========' original ascii art by joan stark:slightly modified by jennifer martino
)===D---- I think you all know... -- "Quis custodiet ipsos custodes?" - Juvenal, Satires, VI, 347
I almost forot to do the dragon smileys... }:=8) Dragon }:===8) Long snouted dragon };=8P Dragon jokin around }:=X8) Cat Dragon }:=8o Dragon with mouth open (probably blowing fire) -- .-'"T"'-. Fulgore, The Slighty Mad! / | \ E-mail :ful...@mindspring.com | | | Webpage:http://www.mindspring.com/~fulgore/main.html | .|. | ICQ :30360347 \ .' | '. / DC2 :DC2.D Gm A- L- W T Pawl Bzz Fo/j+ R+++ Ac+ Cwh/bl_ sw'-.,|,.-' J+++! Ns S+ Fr+++! U! I H++ M--- Q+++! Tc++ Skm
Hi
=(:o) Homer simpson
=8-) Myself
08-) Angel
�:-=( Uhm, a guy that started the 2nd World war...
[-) Guy with Sunglasses
:8-) �hm, marscho?;-)
:-? Smoker
-(:== the last Unicorn
:=O: | Alien
+-:-| the Pope!
--
\\//o\__ __ (o) |\ /|\___ __ :-(o_)^(o_)-:[THA ULTIMATIVE]
.:::::::::. []\_/o ) / (\\ ||V||o\o ) /_ : < : //"\\||//|\ /|
:' __ __ ': ||\\_\||// ||\\_\o\:. _..._ .: ||\\|| ( ||V||
:-( o)^( o)-: ||\\ \_/ :. '---' .: \\_\\||\\|| ||
On Sat, 24 Jun 2000 17:04:17 +0200, Yorck Babinsky <Yor...@web.de>
decided to tell us all:
> �:-=( Uhm, a guy that started the 2nd World war...
Rediddle:
(/:o=(
--
mailto:sara(a)wallen.as ** icq:32690270 ** http://www.saraw.clara.net
Non illegitimi carborundum est. Don't let the bastards grind you down.
^O^ Bats
^O^ ^O^ ^O^ ^O^
^O^ ^O^ ^O^ ^O^ ^O^
^O^ ^O^ ^O^
^O^
^O^ ^O^ ^O^ ^O^
^O^
bly
--
_ /�# ----------------+-------------------------
� \ / Andrea | arimicci @@
|++~| Rimicci | aritaly. com
\ / --------- OS/2 V5 "Phoenix" --------------------
| The MIDI JukeBox:
_|_ http://www.aritaly.com/eng/midi/
---------------------------------------------------------
> ^O^ Bats > ^O^ ^O^ ^O^ ^O^ > ^O^ ^O^ ^O^ ^O^ ^O^ > ^O^ ^O^ ^O^ > ^O^ > ^O^ ^O^ ^O^ ^O^ > ^O^ > bly or you could... ___ | | | | | | | | | | | | | | | | | | |===| | | \ / | | |_| -- .-'"T"'-. Fulgore, The Slighty Mad! / | \ E-mail :ful...@mindspring.com | | | Webpage:http://www.mindspring.com/~fulgore/main.html | .|. | ICQ :30360347 \ .' | '. / DC2 :DC2.D Gm A- L- W T Pawl Bzz Fo/j+ R+++ Ac+ Cwh/bl_ sw'-.,|,.-' J+++! Ns S+ Fr+++! U! I H++ M--- Q+++! Tc++ Skm
On Sat, 24 Jun 2000 17:04:17 +0200, Yorck Babinsky <Yor...@web.de> wrote:
> =(:o) Homer simpson
You forgot the most important thing, Homer's famous quote:
=(:o) <(d'oh!)
Andreas Krennmair
--
#define QUESTION ((bb) || !(bb))
-- Shakespeare
On Sat, 24 Jun 2000 17:05:04 +0100, sara wallen <sar...@REMOVE2REPLYyahoo.co.uk> provoked the following text: >> �:-=( Uhm, a guy that started the 2nd World war... > >Rediddle: > >(/:o=( I find this one more accurate: ':=( -- Peter Punk \ / ---\\\\--- / \ Visit my MIDI-site at http://members.xoom.com/miditation An Englishman never enjoys himself, except for a noble purpose. -- A. P. Herbert
Howdy
> }:=8o Dragon with mouth open (probably blowing fire)
):=8? Dragon without fire!Only smoke!
scnr
--
\\//o\__ __ (o) |\ /|\___ __ :-(o_)^(o_)-:[THA ULTIMATIVE]
.:::::::::. []\_/o ) / (\\ ||V||o\o ) /_ : < : //"\\||//|\ /|
:' __ __ ': ||\\_\||// ||\\_\o\:. _..._ .: ||\\|| ( ||V||
:-( o)^( o)-: ||\\ \_/ :. '---' .: \\_\\||\\|| ||
Peter Punk schrieb: > > On Sat, 24 Jun 2000 17:05:04 +0100, sara wallen > <sar...@REMOVE2REPLYyahoo.co.uk> provoked the following text: > > >> �:-=( Uhm, a guy that started the 2nd World war... > > > >Rediddle: > > > >(/:o=( > > I find this one more accurate: > ':=( Yeah, that was what i was triyung to show! -- \\//o\__ __ (o) |\ /|\___ __ :-(o_)^(o_)-:[THA ULTIMATIVE] .:::::::::. []\_/o ) / (\\ ||V||o\o ) /_ : < : //"\\||//|\ /| :' __ __ ': ||\\_\||// ||\\_\o\:. _..._ .: ||\\|| ( ||V|| :-( o)^( o)-: ||\\ \_/ :. '---' .: \\_\\||\\|| ||
On 24 Jun 2000 19:12:39 GMT, a.k...@aon.at (Andreas Krennmair) wrote: >On Sat, 24 Jun 2000 17:04:17 +0200, Yorck Babinsky <Yor...@web.de> wrote: >> =(:o) Homer simpson >You forgot the most important thing, Homer's famous quote: >=(:o) <(d'oh!) (_8(|) < D'OH!) -- Jan-Erik Finnberg whe...@saunalahti.fi ICQ:49316651 Visit http://www.saunalahti.fi/~wheany/FFVII/ for Final fantasy 7 midis and not much more!!
On Sat, 24 Jun 2000 11:24:27 -0700, Fulgore <ful...@mindspring.com>
wrote:
:> ^O^ Bats
:or you could...
: ___
: | |
: | |
: | |
: | |
: | |
: | |
: | |
: | |
: | |
: |===|
: | |
: \ /
: | |
: |_|
And a one-liner: (#######)==o
--
Jan-Erik Finnberg whe...@saunalahti.fi ICQ:49316651
Visit http://www.saunalahti.fi/~wheany/FFVII/
for Final fantasy 7 midis and not much more!!
Hi! Yorck Babinsky wrote: > > > О©╫:-=( Uhm, a guy that started the 2nd World war... > > Rediddle: > > (/:o=( > hm, the hair isnt absolut correct! > Any help for that? y:= x Maybe, this one?? ad
Fulgore wrote: > I almost forot to do the dragon smileys... > }:=8) Dragon > }:===8) Long snouted dragon > };=8P Dragon jokin around > }:=X8) Cat Dragon > }:=8o Dragon with mouth open (probably blowing fire) -= dragon quotation I'm using =:) any smile goes here ^^ ) -= full variant has 3 strings =:o ) __________ mailto: /\__ __/\WW ad at | \/ |WW nu.umn.ru \ <*>||<*> /WWW | oo |\WWWW \VvvvvV/ /WWWW (^^^^) /WWWW /||||_/WWWW /_____/WWWW ADGROUP-RIPN /_____/WWWW /^^^^^\ From Hell With Love, /^^^^\ =\/\/\/===| Always yours, ad |==\/\/\/= =========================================
On Sun, 25 Jun 2000 19:34:15 +0200, Yorck Babinsky <Yor...@web.de> provoked the following text: >> >> �:-=( Uhm, a guy that started the 2nd World war... >> >Rediddle: >> >(/:o=( >> I find this one more accurate: >> ':=( >Yeah, that was what i was triyung to show! But i perfer to depict him like this: * What's left of him now. -- Peter Punk \ / ---\\\\--- / \ Visit my MIDI-site at http://members.xoom.com/miditation Slang is language that takes off its coat, spits on its hands, and goes to work.
Hey > But i perfer to depict him like this: > > * yeah, its better this way! -- \\//o\__ __ (o) |\ /|\___ __ :-(o_)^(o_)-:[THA ULTIMATIVE] .:::::::::. []\_/o ) / (\\ ||V||o\o ) /_ : < : //"\\||//|\ /| :' __ __ ': ||\\_\||// ||\\_\o\:. _..._ .: ||\\|| ( ||V|| :-( o)^( o)-: ||\\ \_/ :. '---' .: \\_\\||\\|| ||
hi > > y:= x > > Maybe, this one?? > Ok! but we alread closed that x-file!;-) -- \\//o\__ __ (o) |\ /|\___ __ :-(o_)^(o_)-:[THA ULTIMATIVE] .:::::::::. []\_/o ) / (\\ ||V||o\o ) /_ : < : //"\\||//|\ /| :' __ __ ': ||\\_\||// ||\\_\o\:. _..._ .: ||\\|| ( ||V|| :-( o)^( o)-: ||\\ \_/ :. '---' .: \\_\\||\\|| ||
Hi, Jennifer! >> ()()():| Marge Simpson nm> ive also seen @@@@:| for marge simpson. See what i find: ,',',',',:) :) P.S. Maybe, my english is bad - sorry. I'm speak at rusian and ukrainian. P.P.S. (russian translit) Est' li zdes' russkie amerikanci (emigranti, etc. )? :) Good luck, Jennifer!
Anatoly Pavlov wrote: > >> ()()():| Marge Simpson > nm> ive also seen @@@@:| for marge simpson. > See what i find: > ,',',',',:) o=|8o) a clown > P.S. Maybe, my english is bad - sorry. > I'm speak at rusian and ukrainian. > P.P.S. (russian translit) Est' li zdes' > russkie amerikanci (emigranti, etc.)? :) Why d'you need emigrants here?? And what a sentence - russian americans?? PS. Russian translit, 2 Anatoly: A chego eto tebye emigranty-to ponadobilis'?? ad
,_(|=| Boba Fett (Star Wars) ( |:-|) Bob Ross (the (dead) painter) | :-) Myself |-| Frank de Boer (Dutch footballer (soccer), famous of his "anoyed" look) |-| Ronald de Boer (Dutch footballer, twin brother of the first one)
bly wrote: > > Can anyone recommend a good site for one-line ASCII art, like ><///>? I'm A few below /s\ superman logo \,( kick in the pants ~ DNA sample |M|/ mail box (`.<o>< catching a fish (`.~ worm on the hook (`. fishing pole /`. lazy day ! -/--- ! The pen is mightier than the sword O='`o motor cycle --lgbeard
Hey!
:^) somebody with a strange Nose!
:-! Another Smoker!
$:(|) homer simpson again...
:-�) the Girl from Hotshots!
--
\\//o\__ __ (o) |\ /|\___ __ :-(o_)^(o_)-:[THA ULTIMATIVE]
.:::::::::. []\_/o ) / (\\ ||V||o\o ) /_ : < : //"\\||//|\ /|
:' __ __ ': ||\\_\||// ||\\_\o\:. _..._ .: ||\\|| ( ||V||
:-( o)^( o)-: ||\\ \_/ :. '---' .: \\_\\||\\|| ||
On Fri, 30 Jun 2000 18:28:57 +0100, Ben Norwood <bdn...@aber.ac.uk>
wrote:
>AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA
Where'd ya get that! That's part of my DNA. It's bad to post private
emails to public groups, but it's even worse to post one's DNA.
ObActuallyThisIsn'tAsciiArtButItDoesn'tHaveAnyNonAsciiCharsEither
Space-dna:
AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA
Obascii:
___
_(((,| What's DNA??
/ _-\\
/ C o\o \
_/_ __\ \ __ __ __ __ __ __ __
/ \ \___/ ) /--X--\ /--X--\ /--X--\ /--
| |\_|\ / /--/ \--\ /--/ \--\ /--/ \--\ /--/
| |# #|/ \__X__/ \__X__/ \__X__/
( / |
| |# # |
| | #|
| | #___n_,_
,-/ 7-' . `\
`-\...\-_ - o /
|# # `---U--'
`-v-^-'\/
\ |_|_ Wny
(___mnnm
--
Jan-Erik Finnberg whe...@saunalahti.fi ICQ:49316651
Visit http://www.saunalahti.fi/~wheany/FFVII/
for Final fantasy 7 midis and not much more!!
--( In alt.ascii-art )-- --(Jan-Erik Finnberg said it like only they can)-- $On Fri, 30 Jun 2000 18:28:57 +0100, Ben Norwood <bdn...@aber.ac.uk> $wrote: $ $>AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA $ $Where'd ya get that! That's part of my DNA. It's bad to post private $emails to public groups, but it's even worse to post one's DNA. $ $ObActuallyThisIsn'tAsciiArtButItDoesn'tHaveAnyNonAsciiCharsEither $ $Space-dna: $ $AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA your dna? thats my dna! unless you are my long lost twin :) -- ._______. ._______. | <> <> | To all who say evolution is to slow to | <> <> | \-|o|-/ make a race as advanced as ours I have \-|o|-/ /___\ only one thing to say. Have you ever seen /___\ (MMM) the Jerry Springer Show? UIN=66618055 (MMM)
Faux_Pseudo wrote: > > --( In alt.ascii-art )-- > --(Jan-Erik Finnberg said it like only they can)-- > $On Fri, 30 Jun 2000 18:28:57 +0100, Ben Norwood <bdn...@aber.ac.uk> > $wrote: > $ > $>AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA > $ > $Where'd ya get that! That's part of my DNA. It's bad to post private > $emails to public groups, but it's even worse to post one's DNA. > $ > $ObActuallyThisIsn'tAsciiArtButItDoesn'tHaveAnyNonAsciiCharsEither > $ > $Space-dna: > $ > $AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA > > your dna? thats my dna! somebody somewhere sometime for 29.95 will sell it > > unless you are my long lost twin :) never let him borrow the t-cells...robbed at youth... __ )==( ( ) Herbal | | Elixir | | China Variety (____) --lgbeard
On Sun, 02 Jul 2000 07:45:23 GMT, Fau...@computer.foo.bar (Faux_Pseudo) wrote: >$>AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA >$Where'd ya get that! That's part of my DNA. It's bad to post private >$emails to public groups, but it's even worse to post one's DNA. >$ObActuallyThisIsn'tAsciiArtButItDoesn'tHaveAnyNonAsciiCharsEither >$Space-dna: >$AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA >your dna? thats my dna! You can have the space-DNA, I think I'll hold on to the boring-yet-safe earthling DNA. _________________ ( MWAHAHAHAHAA!!! ) Y _ AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA '. Y --(Aww, crap!) - ---- \C_/ <|\ - ---- |_ / \AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA '\/ \, -- Jan-Erik Finnberg whe...@saunalahti.fi ICQ:49316651 Visit http://www.saunalahti.fi/~wheany/FFVII/ for Final fantasy 7 midis and not much more!!
>> >> �:-=( Uhm, a guy that started the 2nd World war... >> >Rediddle: >> >(/:o=( >> I find this one more accurate: >> ':=( >Yeah, that was what i was triyung to show! I'd say it's better this way: 7:=(
About this thread.
These messages were posted publicly to the newsgroup
alt.ascii-art
in 2000 and are mirrored here unchanged as part of the Historic Archives – only email addresses are masked.
The artwork and text belong to their original authors: if you copy a piece, keep the artist's initials or signature intact and credit them where you can.
Are you one of the authors? Contact us to get your posts attributed, connected to your artist profile, or removed.