Re: One-Liners
From Faux_Pseudo <Fau...@computer.foo.bar>
· alt.ascii-art
· 2 Jul 2000 00:00 · View full thread
· report
--( In alt.ascii-art )-- --(Jan-Erik Finnberg said it like only they can)-- $On Fri, 30 Jun 2000 18:28:57 +0100, Ben Norwood <bdn...@aber.ac.uk> $wrote: $ $>AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA $ $Where'd ya get that! That's part of my DNA. It's bad to post private $emails to public groups, but it's even worse to post one's DNA. $ $ObActuallyThisIsn'tAsciiArtButItDoesn'tHaveAnyNonAsciiCharsEither $ $Space-dna: $ $AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA your dna? thats my dna! unless you are my long lost twin :) -- ._______. ._______. | <> <> | To all who say evolution is to slow to | <> <> | \-|o|-/ make a race as advanced as ours I have \-|o|-/ /___\ only one thing to say. Have you ever seen /___\ (MMM) the Jerry Springer Show? UIN=66618055 (MMM)
Original message headers
X-Google-Language: ENGLISH,ASCII-7-bit X-Google-Thread: f996b,83b741a81f8a020d X-Google-Attributes: gidf996b,public From: Fau...@computer.foo.bar (Faux_Pseudo) Subject: Re: One-Liners Date: 2000/07/02 Message-ID: <nqC75.2438$oh5...@bgtnsc04-news.ops.worldnet.att.net>#1/1 X-Deja-AN: 641422471 References: <8ird1v$5harh$1...@fu-berlin.de> <395...@bellsouth.net> <Pine.GSO.4.21.0006301825410.21095-100000@malcolmx> <zT5...@4ax.com> X-Complaints-To: abu...@worldnet.att.net X-Trace: bgtnsc04-news.ops.worldnet.att.net 962523923 12.72.25.248 (Sun, 02 Jul 2000 07:45:23 GMT) Organization: AT&T Worldnet User-Agent: slrn/0.9.6.2 (Win32) Reply-To: Fau...@yahoo.com NNTP-Posting-Date: Sun, 02 Jul 2000 07:45:23 GMT X-Why: are you reading this Newsgroups: alt.ascii-art
Related ASCII art in the Gallery
Explore these categories from our collection of 11,000+ artworks:
_ _ (o)(o)--. \../ ( )hjw m\/m--m'`--.
_ _
/` \/ `\_ _
\ /` \/ `\
'. .\ /
\/ '. .'
\/jgs __ . . __ (o.\ \/ /.o) \__\/\/__/ /O /==\ O\ (;O/ \/ \O;)
_______ |.-----.| || jgs || ||_ _|| `--)-(--` __[=== o]___ |:::::::::::|\ `-=========-`()
,sSSs ,SSSS_/ ,_ sS/`))\// sS//|_(_/ _, SS\\\ `""-.-'` / sSS` jgs-==-'`'-._\
___________ | _______ | | | | | | | | | | | | | | |_______| | |___________|
Make your own ASCII art
Turn images, text or 3D into ASCII, or draw your own – right in your browser.
About this message.
This message was posted publicly to the newsgroup
alt.ascii-art
in 2000 and is mirrored here unchanged as part of the Historic Archives – only email addresses are masked.
The artwork and text belong to their original authors: if you copy a piece, keep the artist's initials or signature intact and credit them where you can.
Are you the author? Contact us to get your posts attributed, connected to your artist profile, or removed.
Report this message
Help us keep the archive clean and accurate. Reports are reviewed by a person – nothing is changed automatically.