Re: One-Liners
From Jan-Erik Finnberg <whe...@saunalahti.fi>
· alt.ascii-art
· 3 Jul 2000 00:00 · View full thread
· report
On Sun, 02 Jul 2000 07:45:23 GMT, Fau...@computer.foo.bar (Faux_Pseudo) wrote: >$>AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA >$Where'd ya get that! That's part of my DNA. It's bad to post private >$emails to public groups, but it's even worse to post one's DNA. >$ObActuallyThisIsn'tAsciiArtButItDoesn'tHaveAnyNonAsciiCharsEither >$Space-dna: >$AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA >your dna? thats my dna! You can have the space-DNA, I think I'll hold on to the boring-yet-safe earthling DNA. _________________ ( MWAHAHAHAHAA!!! ) Y _ AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA '. Y --(Aww, crap!) - ---- \C_/ <|\ - ---- |_ / \AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA '\/ \, -- Jan-Erik Finnberg whe...@saunalahti.fi ICQ:49316651 Visit http://www.saunalahti.fi/~wheany/FFVII/ for Final fantasy 7 midis and not much more!!
Original message headers
X-Google-Language: ENGLISH,ASCII-7-bit X-Google-Thread: f996b,83b741a81f8a020d X-Google-Attributes: gidf996b,public From: Jan-Erik Finnberg <whe...@saunalahti.fi> Subject: Re: One-Liners Date: 2000/07/03 Message-ID: <RuNgOcO=sxO...@4ax.com>#1/1 X-Deja-AN: 641941156 Content-Transfer-Encoding: 7bit References: <8ird1v$5harh$1...@fu-berlin.de> <395...@bellsouth.net> <Pine.GSO.4.21.0006301825410.21095-100000@malcolmx> <zT5...@4ax.com> <nqC75.2438$oh5...@bgtnsc04-news.ops.worldnet.att.net> Content-Type: text/plain; charset=us-ascii X-Complaints-To: new...@saunalahti.fi X-Trace: tron.sci.fi 962651803 18293 195.197.47.93 (3 Jul 2000 19:16:43 GMT) Organization: SAUNALAHDEN asiakas Mime-Version: 1.0 NNTP-Posting-Date: 3 Jul 2000 19:16:43 GMT Newsgroups: alt.ascii-art
Related ASCII art in the Gallery
Explore these categories from our collection of 11,000+ artworks:
Make your own ASCII art
Turn images, text or 3D into ASCII, or draw your own – right in your browser.
About this message.
This message was posted publicly to the newsgroup
alt.ascii-art
in 2000 and is mirrored here unchanged as part of the Historic Archives – only email addresses are masked.
The artwork and text belong to their original authors: if you copy a piece, keep the artist's initials or signature intact and credit them where you can.
Are you the author? Contact us to get your posts attributed, connected to your artist profile, or removed.
Report this message
Help us keep the archive clean and accurate. Reports are reviewed by a person – nothing is changed automatically.