Settings

The page will reload to apply your changes.
Theme

ASCII Art Font

ASCII Art Menu

Original Usenet message from alt.ascii-art, 3 Jul 2000.
Re: One-Liners

Re: One-Liners

On Sun, 02 Jul 2000 07:45:23 GMT, Fau...@computer.foo.bar
(Faux_Pseudo) wrote:

>$>AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA

>$Where'd ya get that! That's part of my DNA. It's bad to post private
>$emails to public groups, but it's even worse to post one's DNA.

>$ObActuallyThisIsn'tAsciiArtButItDoesn'tHaveAnyNonAsciiCharsEither

>$Space-dna:

>$AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA  

>your dna? thats my dna!

You can have the space-DNA, I think I'll hold on to the boring-yet-safe
earthling DNA.
                                                      _________________
                                                     ( MWAHAHAHAHAA!!! )
                                                                  Y
  _     AAGGTTCAAGTCCAATGCCTTAACTGACCAATGGTCCATGTCCATGTTCCCTTGGA  '.
  Y --(Aww, crap!)                                     - ----   \C_/
 <|\                                                  -  ----    |_
 / \AAGGTTCAAGTCCAATTPPGGNNPGTNPPNATGGTCCATGTCCATGTTCCCTTGGA  '\/  \,


-- 
Jan-Erik Finnberg           whe...@saunalahti.fi           ICQ:49316651

Visit http://www.saunalahti.fi/~wheany/FFVII/
for Final fantasy 7 midis and not much more!!

Original message headers
X-Google-Language: ENGLISH,ASCII-7-bit
X-Google-Thread: f996b,83b741a81f8a020d
X-Google-Attributes: gidf996b,public
From: Jan-Erik Finnberg <whe...@saunalahti.fi>
Subject: Re: One-Liners
Date: 2000/07/03
Message-ID: <RuNgOcO=sxO...@4ax.com>#1/1
X-Deja-AN: 641941156
Content-Transfer-Encoding: 7bit
References: <8ird1v$5harh$1...@fu-berlin.de> <395...@bellsouth.net> <Pine.GSO.4.21.0006301825410.21095-100000@malcolmx> <zT5...@4ax.com> <nqC75.2438$oh5...@bgtnsc04-news.ops.worldnet.att.net>
Content-Type: text/plain; charset=us-ascii
X-Complaints-To: new...@saunalahti.fi
X-Trace: tron.sci.fi 962651803 18293 195.197.47.93 (3 Jul 2000 19:16:43 GMT)
Organization: SAUNALAHDEN asiakas
Mime-Version: 1.0
NNTP-Posting-Date: 3 Jul 2000 19:16:43 GMT
Newsgroups: alt.ascii-art
About this message. This message was posted publicly to the newsgroup alt.ascii-art in 2000 and is mirrored here unchanged as part of the Historic Archives – only email addresses are masked. The artwork and text belong to their original authors: if you copy a piece, keep the artist's initials or signature intact and credit them where you can. Are you the author? Contact us to get your posts attributed, connected to your artist profile, or removed.

Report this message

Help us keep the archive clean and accurate. Reports are reviewed by a person – nothing is changed automatically.

Help classify this post